bmp1a

Ensembl ID:
ENSDARG00000028071
ZFIN ID:
ZDB-GENE-060818-1
Description:
bone morphogenetic protein 1a [Source:RefSeq peptide;Acc:NP_001035126]
Human Orthologue:
BMP1
Human Description:
bone morphogenetic protein 1 [Source:HGNC Symbol;Acc:1067]
Mouse Orthologue:
Bmp1
Mouse Description:
bone morphogenetic protein 1 Gene [Source:MGI Symbol;Acc:MGI:88176]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7161 Essential Splice Site Mutation detected in F1 DNA During 2016
sa2416 Nonsense Available for shipment Available now
sa34508 Nonsense Mutation detected in F1 DNA During 2016
sa12765 Essential Splice Site Available for shipment Available now
sa17110 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7161
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127875 Essential Splice Site 210 1013 5 20
Genomic Location (Zv9):
Chromosome 8 (position 53508618)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51245530
KASP Assay ID:
554-5387.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGATTGTGTTCTTTGSATATTAACTGTAGTGTTTATTGYGCTGTCCTCA[G/T]GTGCWGTTCATACGTGGGCCGCAGAGGAGGGGGTCCGCAGGCCATWTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2416
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127875 Nonsense 522 1013 12 20
Genomic Location (Zv9):
Chromosome 8 (position 53469811)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51206723
KASP Assay ID:
554-2518.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGCAAGATCGAGAGGCATGATAACTGTGCGTACGACTACCTGGAGGTT[C/T]GAGACGGGAACTCRGAAAGCAGCCCGCTTTTGGGCAGGTTCTGCGGTTAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa34508
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127875 Nonsense 646 1013 14 20
Genomic Location (Zv9):
Chromosome 8 (position 53462479)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51199391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGTCCCGGCTGGCCCAAAGAGTACCCACCTAACAAGAACTGCATCTGG[C/T]AGCTCGTGGCGCCGACGCAGTACCGCATCACGCTGCTTTTCGACGTCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12765
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127875 Essential Splice Site 668 1013 14 20
ENSDART00000127875 Essential Splice Site 668 1013 14 20
Genomic Location (Zv9):
Chromosome 8 (position 53462410)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51199322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTACCGCATCAMGCTGCTTTTCGACGTCTTCGAGACCGAGGGCAACGAT[G/A]TGAGCACTAGRTTTTTACCACTGAGWRGGGTGGGTCTGTCYGGTTCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17110
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127875 Essential Splice Site 668 1013 14 20
ENSDART00000127875 Essential Splice Site 668 1013 14 20
Genomic Location (Zv9):
Chromosome 8 (position 53462410)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51199322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTACCGCATCAMGCTGCTTTTCGACGTCTTCGAGACCGAGGGCAACGAT[G/A]TGAGCACTAGRTTTTTACCACTGAGWRGGGTGGGTCTGTCYGGTTCATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link