diras1a

Ensembl ID:
ENSDARG00000028066
ZFIN ID:
ZDB-GENE-030131-5788
Description:
DIRAS family, GTP-binding RAS-like 1a [Source:RefSeq peptide;Acc:NP_956125]
Human Orthologue:
DIRAS1
Human Description:
DIRAS family, GTP-binding RAS-like 1 [Source:HGNC Symbol;Acc:19127]
Mouse Orthologue:
Diras1
Mouse Description:
DIRAS family, GTP-binding RAS-like 1 Gene [Source:MGI Symbol;Acc:MGI:2183442]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5591 Essential Splice Site F2 line generated During 2017
sa35021 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5591
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031937 Essential Splice Site None 195 2 2
ENSDART00000031937 Essential Splice Site None 195 2 2
Genomic Location (Zv9):
Chromosome 11 (position 7485655)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7329758
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAGTTGTTTTCTCTACATATAAACCAAGTGAAACTTCTTTCCCTTTTC[A/G]GATCTCAGGGAATAACTGAGTCTTAAGCAGCAGATACTCCAGCAGATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35021
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031937 Nonsense 191 195 2 2
Genomic Location (Zv9):
Chromosome 11 (position 7486286)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7330389
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGAACATGCGCTCCAGCAAGCAGAGACGGGCAGACAAGCTGAAGGCC[A/T]AGTGCAGTGTGATGTAGGAAGCCGCATCTATGGTCGCATCACTCAACTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link