traf6

Ensembl ID:
ENSDARG00000028058
ZFIN ID:
ZDB-GENE-030131-5735
Description:
TNF receptor-associated factor 6 [Source:UniProtKB/Swiss-Prot;Acc:Q6IWL4]
Human Orthologue:
TRAF6
Human Description:
TNF receptor-associated factor 6 [Source:HGNC Symbol;Acc:12036]
Mouse Orthologue:
Traf6
Mouse Description:
TNF receptor-associated factor 6 Gene [Source:MGI Symbol;Acc:MGI:108072]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa244 Nonsense F2 line generated During 2014
sa151 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa244
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038273 Nonsense 19 542 2 7
Genomic Location:
Chromosome 7 (position 50190596)
KASP Assay ID:
554-2571.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGCAAYGACGTGGACAAGTCCAGCTTCGAYGATGTCTGCTGTGACAGC[G/T]GACACTCGAGTTGTGCTGCAGCTATGGAGAAGGAGAGGGAGTCGTTTCTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa151
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038273 Nonsense 166 542 4 7
Genomic Location:
Chromosome 7 (position 50185417)
KASP Assay ID:
554-0746.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAACACTTGTCTCAGTGCAGGTTTGCCACTGCGCCGTGCCCTCAATG[T/A]CAGGAGTCTGTTCCCATAAGCCACCTGGATGAACATAAGAGCCAGCATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dgkqrpfl