im:7138629

Ensembl ID:
ENSDARG00000028056
ZFIN IDs:
ZDB-GENE-050208-92, ZDB-GENE-050208-92
Description:
Im:7138629 protein [Source:UniProtKB/TrEMBL;Acc:Q5CZP7]
Human Orthologue:
KNTC1
Human Description:
kinetochore associated 1 [Source:HGNC Symbol;Acc:17255]
Mouse Orthologue:
Kntc1
Mouse Description:
kinetochore associated 1 Gene [Source:MGI Symbol;Acc:MGI:2673709]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30622 Nonsense Mutation detected in F1 DNA During 2016
sa13054 Essential Splice Site Available for shipment Available now
sa33760 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33761 Nonsense Mutation detected in F1 DNA During 2016
sa31487 Nonsense Mutation detected in F1 DNA During 2016
sa26620 Nonsense Mutation detected in F1 DNA During 2016
sa33762 Nonsense Mutation detected in F1 DNA During 2016
sa2200 Nonsense F2 line generated During 2016
sa9431 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30622
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338   None 522 None 16
ENSDART00000097285 Nonsense 493 859 22 32
ENSDART00000124886   None 1025 None 27
Genomic Location (Zv9):
Chromosome 5 (position 69452104)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65778943
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGCCCCAGAACTGATTCCTGCAGTAGTCGAGAGCAGCGTTGAACCATA[C/A]GCTCTAGAGAATGGATTGGACCTGGACCAGACTCTACTAGATTATATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13054
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338   None 522 None 16
ENSDART00000097285 Essential Splice Site 612 859 26 32
ENSDART00000124886   None 1025 None 27
Genomic Location (Zv9):
Chromosome 5 (position 69457535)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65784366
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTCTTTGGTCTTTCAAGTACCTGATATTACATGTTGTTTRCTTTGCTT[A/T]GATGCTTGTGAGGTACATCCTGAAGCAAGACCTGCCCACTTCTCTRGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33760
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338   None 522 None 16
ENSDART00000097285 Essential Splice Site 656 859 26 32
ENSDART00000124886   None 1025 None 27
Genomic Location (Zv9):
Chromosome 5 (position 69457673)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65784504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGAGTTCCACCATCTTCACTGCATCCAGCTTATACAGCGCAACAAGG[T/C]ATTACTCTTACAGAATTGACTATTCTTCTTAAGATTATGAAGGGCACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33761
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338   None 522 None 16
ENSDART00000097285 Nonsense 777 859 31 32
ENSDART00000124886   None 1025 None 27
Genomic Location (Zv9):
Chromosome 5 (position 69467299)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65794075
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAATACATGTTTCTGTTTACCTCATGAAGCGAGTTATATCAGCACCACT[C/A]GAACTGCAGCACAGGACGTGTTTTGTTCAGCACCGCCCAGCGCCTCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31487
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338   None 522 None 16
ENSDART00000097285   None 859 None 32
ENSDART00000124886 Nonsense 32 1025 2 27
Genomic Location (Zv9):
Chromosome 5 (position 69469985)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65795808
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTATGTGTTTTCAAGGAATCTTCAATGAGTGGTGAAGAGGATGCGTA[T/A]GCCGAATCCCATTTTCACGATGTGTTCAATGAGGATGGCATTGTGCTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26620
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338   None 522 None 16
ENSDART00000097285   None 859 None 32
ENSDART00000124886 Nonsense 429 1025 11 27
Genomic Location (Zv9):
Chromosome 5 (position 69478475)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65803404
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCCATAGACGAATATCTCCCCCCACTGACCTGGAGAGCTCATATCTTT[T/A]GGAAAACAGTCTTGAACCCACTGCTCTAGCTAACACTCGCTTGCCTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33762
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338 Nonsense 120 522 3 16
ENSDART00000097285   None 859 None 32
ENSDART00000124886 Nonsense 681 1025 16 27
Genomic Location (Zv9):
Chromosome 5 (position 69489616)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65814374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTAAAGATCCGGAATATTCTTCTGGAGAAGTGGTTATGTCAAACAGGG[C/T]AGTCTAATGGCAAGGTATGGATATGGTACTTTACCTAGGTTCATTTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2200
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338 Nonsense 470 522 14 16
ENSDART00000097285   None 859 None 32
ENSDART00000124886   None 1025 None 27
Genomic Location (Zv9):
Chromosome 5 (position 69505925)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65830428
KASP Assay ID:
554-2506.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAAGGGTCGTTCTGAAGCAGTGCTGGAGCTGCTGAATTGCCTTGTGGAG[C/T]AAAAAGGGTTAGTTGGTCCTACGTCTAATTTTTAATAAATAATGTTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9431
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338 Nonsense 483 522 15 16
ENSDART00000097285   None 859 None 32
ENSDART00000124886   None 1025 None 27
Genomic Location (Zv9):
Chromosome 5 (position 69508448)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65832951
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCTYTCTCTAAATAGTGAAGATGAGGCCMTTTSCTTTGCTAATGAATA[T/A]CTGCAAWRCCGARATCTGAAAGGAGAGAAAACGGCACCTGTGAGCGACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link