im:7138629

Ensembl ID:
ENSDARG00000028056
ZFIN IDs:
ZDB-GENE-050208-92, ZDB-GENE-050208-92
Description:
Im:7138629 protein [Source:UniProtKB/TrEMBL;Acc:Q5CZP7]
Human Orthologue:
KNTC1
Human Description:
kinetochore associated 1 [Source:HGNC Symbol;Acc:17255]
Mouse Orthologue:
Kntc1
Mouse Description:
kinetochore associated 1 Gene [Source:MGI Symbol;Acc:MGI:2673709]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13054 Essential Splice Site Available for shipment Available now
sa2200 Nonsense F2 line generated During 2014
sa9431 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13054
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338 None None 522 None 16
ENSDART00000097285 Essential Splice Site 612 859 26 32
ENSDART00000124886 None None 1025 None 27
Genomic Location:
Chromosome 5 (position 69457535)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTCTTTGGTCTTTCAAGTACCTGATATTACATGTTGTTTRCTTTGCTT[A/T]GATGCTTGTGAGGTACATCCTGAAGCAAGACCTGCCCACTTCTCTRGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2200
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338 Nonsense 470 522 14 16
ENSDART00000097285 None None 859 None 32
ENSDART00000124886 None None 1025 None 27
Genomic Location:
Chromosome 5 (position 69505925)
KASP Assay ID:
554-2506.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAAGGGTCGTTCTGAAGCAGTGCTGGAGCTGCTGAATTGCCTTGTGGAG[C/T]AAAAAGGGTTAGTTGGTCCTACGTCTAATTTTTAATAAATAATGTTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9431
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038338 Nonsense 483 522 15 16
ENSDART00000097285 None None 859 None 32
ENSDART00000124886 None None 1025 None 27
Genomic Location:
Chromosome 5 (position 69508448)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCTYTCTCTAAATAGTGAAGATGAGGCCMTTTSCTTTGCTAATGAATA[T/A]CTGCAAWRCCGARATCTGAAAGGAGAGAAAACGGCACCTGTGAGCGACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5otzrj27