bmp1b

Ensembl ID:
ENSDARG00000028053
ZFIN ID:
ZDB-GENE-060818-2
Description:
bone morphogenetic protein 1b [Source:RefSeq peptide;Acc:NP_001034901]
Human Orthologue:
BMP1
Human Description:
bone morphogenetic protein 1 [Source:HGNC Symbol;Acc:1067]
Mouse Orthologue:
Bmp1
Mouse Description:
bone morphogenetic protein 1 Gene [Source:MGI Symbol;Acc:MGI:88176]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41729 Nonsense Mutation detected in F1 DNA During 2016
sa31800 Nonsense Available for shipment Available now
sa948 Nonsense F2 line generated During 2016
sa8469 Nonsense Mutation detected in F1 DNA During 2016
sa27675 Nonsense Mutation detected in F1 DNA During 2016
sa31799 Essential Splice Site Available for shipment Available now
sa11102 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41729
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059795 Nonsense 131 969 4 20
ENSDART00000134295 Nonsense 131 261 4 6
Genomic Location (Zv9):
Chromosome 10 (position 42288543)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 41001252
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCCCTCAGCTTTTTTACTGATTAAAACCAAACTGTTGCAGGCAGCCAG[C/T]GAGCCATTTTCAAGCAAGCCATGCGTCACTGGGAGAAACACACTTGCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31800
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059795 Nonsense 386 969 10 20
ENSDART00000134295   None 261 None 6
Genomic Location (Zv9):
Chromosome 10 (position 42254376)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 40967085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGTTTGTTGCATTTGCTTTAGGCCGCATATGTGGAGATCAGCTCCCT[G/T]AGGCCATCGTGTCCACAGACAGCGAACTGTGGATTGAGTTTCGCAGCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa948
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059795 Nonsense 428 969 11 20
ENSDART00000134295   None 261 None 6
Genomic Location (Zv9):
Chromosome 10 (position 42254169)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 40966878
KASP Assay ID:
554-0853.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTACCCTGTTTCAGCAATTTGYGGAGGCGAAGTGAGACGAGACAGCGGA[C/T]AGATCGAATCTCCAAATTACCCTGATGACTATCGGCCAAATAAAGCGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8469
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059795 Nonsense 555 969 13 20
ENSDART00000134295   None 261 None 6
Genomic Location (Zv9):
Chromosome 10 (position 42249533)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 40962242
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGCTCACTGTGAGCAGCGCTGCATCAACAMACTGGGCAGCTTCCACTG[C/A]GCCTGCGACCCTGGCTTTGAGCTCGCCCCGGACAGAMGGAGCTGCGCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27675
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059795 Nonsense 629 969 15 20
ENSDART00000134295   None 261 None 6
Genomic Location (Zv9):
Chromosome 10 (position 42241968)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 40954677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATAGCCCCTCTTTAACTGTTGCTTGTCTGTCCACAGGTTTGTAAATA[T/A]GATTATGTTGAAGTCCACAGTGGTTTGTCGGCTGACGGAAAGCTTCACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31799
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059795 Essential Splice Site 770 969 17 20
ENSDART00000134295   None 261 None 6
Genomic Location (Zv9):
Chromosome 10 (position 42234751)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 40947460
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTTGCACATGGACCCTCTCCACCACCCCTGGACACCGCATTAAACTG[G/A]TACACACTTCAATTAACCTTACAATATGAGTGGTTAAAGACCCACTATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11102
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059795 Nonsense 788 969 18 20
ENSDART00000134295   None 261 None 6
Genomic Location (Zv9):
Chromosome 10 (position 42232435)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 40945144
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCGAGGAGATTGACATGGAGGCTCATCAGGAATGTGCTTATGACCACT[T/A]GGAGATTTACGACGGACAAAATGGCAGAGCGACCAGCGTCGGCCGCTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link