si:ch73-73n3.1

Ensembl ID:
ENSDARG00000028000
ZFIN ID:
ZDB-GENE-091112-22
Human Orthologue:
PFKP
Human Description:
phosphofructokinase, platelet [Source:HGNC Symbol;Acc:8878]
Mouse Orthologue:
Pfkp
Mouse Description:
phosphofructokinase, platelet Gene [Source:MGI Symbol;Acc:MGI:1891833]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44075 Nonsense Mutation detected in F1 DNA During 2017
sa37810 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44075
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033394 Nonsense 7 787 1 22
ENSDART00000131753   None 327 None 10
Genomic Location (Zv9):
Chromosome 24 (position 4041667)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 3932160
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTAATATATTGTAAGTAACAAAAGGGAAAATGGCTCAATCGGACAAT[A/T]AGAGGTTTTTTGAGAACCTGACAGGCGCTGGGAAAGCCATCGCGGTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37810
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033394 Nonsense 510 787 16 22
ENSDART00000131753   None 327 None 10
Genomic Location (Zv9):
Chromosome 24 (position 4075087)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 3965580
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCCTTGCTGTGTTGTGCTGACCTTTCAAAGGCCTTAGAGTGTCTGCTG[C/T]AGCTGAATGAGGCTCGGGCCAAATATGAGGAGTTTTGCATCCCGCTCTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link