hao2

Ensembl ID:
ENSDARG00000027992
ZFIN ID:
ZDB-GENE-040426-1239
Description:
hydroxyacid oxidase 2 [Source:RefSeq peptide;Acc:NP_956777]
Human Orthologue:
HAO2
Human Description:
hydroxyacid oxidase 2 (long chain) [Source:HGNC Symbol;Acc:4810]
Mouse Orthologue:
Hao2
Mouse Description:
hydroxyacid oxidase 2 Gene [Source:MGI Symbol;Acc:MGI:96012]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27378 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27378
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035428   None 357 None 8
ENSDART00000122139 Splice Site, Nonsense 14 378 1 8
ENSDART00000133903   None 165 None 4
ENSDART00000136365 Splice Site, Nonsense 14 223 2 6
Genomic Location (Zv9):
Chromosome 9 (position 22181628)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21337414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATGCAGAGATGGAGCGCCATAAAAGAATGAACTTACTGGGCTCTAGC[A/T]GGTAAGTGATTAGCAGTTTGCTAATTCAACAACCAAAGAAGTAACTTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link