ap1s3b

Ensembl ID:
ENSDARG00000027966
ZFIN ID:
ZDB-GENE-040912-62
Description:
AP-1 complex subunit sigma-3 [Source:RefSeq peptide;Acc:NP_001004635]
Human Orthologue:
AP1S3
Human Description:
adaptor-related protein complex 1, sigma 3 subunit [Source:HGNC Symbol;Acc:18971]
Mouse Orthologue:
Ap1s3
Mouse Description:
adaptor-related protein complex AP-1, sigma 3 Gene [Source:MGI Symbol;Acc:MGI:1891304]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19873 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19873
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038228 Essential Splice Site None 153 1 5
Genomic Location:
Chromosome 2 (position 47743430)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAATTCTGTGCATTTCAACACTCCTGGCGTATTTCCTGCTTCAAAATGG[T/G]AAGTTAAACGTTATATTCTTTTGATTCGCCTCAAAACCCAAAGTTAGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/onf81pi4