LOC567243

Ensembl ID:
ENSDARG00000027963
Human Orthologue:
CAMKV
Human Description:
CaM kinase-like vesicle-associated [Source:HGNC Symbol;Acc:28788]
Mouse Orthologue:
Camkv
Mouse Description:
CaM kinase-like vesicle-associated Gene [Source:MGI Symbol;Acc:MGI:2384296]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20794 Essential Splice Site Available for shipment Available now
sa9926 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20794
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036301 Essential Splice Site 285 386 8 10
Genomic Location (Zv9):
Chromosome 6 (position 42525487)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42596541
KASP Assay ID:
2259-8000.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGACCAGGACCAACGACTGACCGCACAGGAAGCCATCAATCATGAGTG[G/A]TAAGGAGACTTTTCAAGTACAATAAATAGAAGCATTGGCTGTTTTATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9926
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036301 Essential Splice Site 285 386 8 10
Genomic Location (Zv9):
Chromosome 6 (position 42525488)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42596542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACCAGGACCAACGACTGACCGCACAGGAAGCCATCAATCATGAGTGG[T/C]AAGGAGACTTTTCAAGTACAATAAATAGAAGCATTGGCTGTYTTATTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link