LOC567243

Ensembl ID:
ENSDARG00000027963
Human Orthologue:
CAMKV
Human Description:
CaM kinase-like vesicle-associated [Source:HGNC Symbol;Acc:28788]
Mouse Orthologue:
Camkv
Mouse Description:
CaM kinase-like vesicle-associated Gene [Source:MGI Symbol;Acc:MGI:2384296]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3578 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20794 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9926 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa3578
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036301 Essential Splice Site 76 386 2 10
Genomic Location:
Chromosome 6 (position 42519955)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAGGAAAGTACGGAAAGCWGCCAAAAACGAGATCCTCATCTTGAAAAT[G/A]TATGTTTTCCCATGCAGGTTATTTATAAGATCCACATTTTAGAGAAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20794
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036301 Essential Splice Site 285 386 8 10
Genomic Location:
Chromosome 6 (position 42525487)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGACCAGGACCAACGACTGACCGCACAGGAAGCCATCAATCATGAGTG[G/A]TAAGGAGACTTTTCAAGTACAATAAATAGAAGCATTGGCTGTTTTATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9926
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036301 Essential Splice Site 285 386 8 10
Genomic Location:
Chromosome 6 (position 42525488)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACCAGGACCAACGACTGACCGCACAGGAAGCCATCAATCATGAGTGG[T/C]AAGGAGACTTTTCAAGTACAATAAATAGAAGCATTGGCTGTYTTATTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jjomex4r