si:ch211-241d21.1

Ensembl ID:
ENSDARG00000027933
ZFIN ID:
ZDB-GENE-081105-172
Description:
Novel protein similar to H.sapiens GLIS family zinc finger [Source:UniProtKB/TrEMBL;Acc:B8JJK6]
Human Orthologue:
GLIS1
Human Description:
GLIS family zinc finger 1 [Source:HGNC Symbol;Acc:29525]
Mouse Orthologue:
Glis1
Mouse Description:
GLIS family zinc finger 1 Gene [Source:MGI Symbol;Acc:MGI:2386723]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31640 Nonsense Available for shipment Available now
sa10106 Nonsense Available for shipment Available now
sa38681 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31640
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029255 Nonsense 376 902 3 10
ENSDART00000140941   None 226 None 3
Genomic Location (Zv9):
Chromosome 8 (position 18620877)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18065765
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTTCTCATACAGCCCGCTGCATTATTGGATGGCTGCACCCCAACGCTG[A/T]AACAAGAACCGGCGGATGAGTTCTCTCCAAGTGAGGAGGAGCTCTTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10106
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029255 Nonsense 450 902 3 10
ENSDART00000140941 Nonsense 32 226 1 3
Genomic Location (Zv9):
Chromosome 8 (position 18621099)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18065987
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCACCAGTACATGGGCTCCGGCCCAGGAGCCCTACTGCATCTTCAGAGC[C/T]AACAGCAGTCTCCACCCTCAGGCCTGCTGGCACAGCCCAAACAAACAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38681
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029255 Nonsense 716 902 7 10
ENSDART00000140941   None 226 None 3
Genomic Location (Zv9):
Chromosome 8 (position 18684500)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18129388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCAGGCCTGTACGCTGGCTCCAGCACGACACACAATGGAGCCCCACTT[G/T]AGTTGCTCTCTTCTGGACCTGACCTGCCACCCAGGCAGCCCCGCATGGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link