ccne2

Ensembl ID:
ENSDARG00000027918
ZFIN IDs:
ZDB-GENE-030131-9689, ZDB-GENE-030131-9689
Description:
G1/S-specific cyclin-E2 [Source:RefSeq peptide;Acc:NP_001002075]
Human Orthologue:
CCNE2
Human Description:
cyclin E2 [Source:HGNC Symbol;Acc:1590]
Mouse Orthologue:
Ccne2
Mouse Description:
cyclin E2 Gene [Source:MGI Symbol;Acc:MGI:1329034]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7804 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7804
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038155 Nonsense 41 392 4 11
ENSDART00000112137 None 55 357 4 10
Genomic Location:
Chromosome 16 (position 43243053)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AMCCTTATTGTCTGCAGTGCAATAGAAGAGTMCCATCAGCAGCTAAGAAA[C/T]AGCATTATGAAATTCAGGTGAGCTCATTTATATGTTCTTTAATATAATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/247ybe0a