fam164a

Ensembl ID:
ENSDARG00000027915
ZFIN ID:
ZDB-GENE-030131-3132
Description:
Protein FAM164A [Source:UniProtKB/Swiss-Prot;Acc:Q7SXT7]
Human Orthologue:
FAM164A
Human Description:
family with sequence similarity 164, member A [Source:HGNC Symbol;Acc:24277]
Mouse Orthologue:
Fam164a
Mouse Description:
family with sequence similarity 164, member A Gene [Source:MGI Symbol;Acc:MGI:1914556]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39449 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39449
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035409 Nonsense 211 327 7 10
ENSDART00000146247 Nonsense 199 282 6 9

The following transcripts of ENSDARG00000027915 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 23354766)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 22601644
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTTCTCGTCTACCTCAGCGCTCAGCTTATGGCCAGGGTGCTGGCACA[G/T]GTAAGGACTTGCATTTATTTTATTGATTGGCCTGTCATTGACCGATTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link