ADAMTSL3

Ensembl ID:
ENSDARG00000027903
Description:
ADAMTS-like 3 [Source:HGNC Symbol;Acc:14633]
Human Orthologue:
ADAMTSL3
Human Description:
ADAMTS-like 3 [Source:HGNC Symbol;Acc:14633]
Mouse Orthologue:
Adamtsl3
Mouse Description:
ADAMTS-like 3 Gene [Source:MGI Symbol;Acc:MGI:3028499]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11069 Essential Splice Site Available for shipment Available now
sa10958 Nonsense Available for shipment Available now
sa25354 Nonsense Mutation detected in F1 DNA During 2014
sa17662 Essential Splice Site Available for shipment Available now
sa20869 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5398 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11069
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052750 Essential Splice Site 489 1760 12 30
Genomic Location:
Chromosome 7 (position 13343977)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCAACACCTTTGACTGTCCGCAGTGGATGGCCATGGAGTGGTCTCAGG[T/G]TMGTGCAGGGTTTCCGCACTATWTACACAATATYATCGAATTTAAAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10958
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052750 Nonsense 508 1760 13 30
Genomic Location:
Chromosome 7 (position 13342965)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCACCTGTGGTCCAGGTTTGCGCTACAGAGTTGTTCTGTGTGTGGATTA[T/G]AATGGTCAACACGCCGGTGGCTGCAATCYTCACCTCAAACCTCATATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25354
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052750 Nonsense 1269 1760 21 30
Genomic Location:
Chromosome 7 (position 13265435)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTCCACCAATGAACTGGGCTCAGATTCAGAAACAACACAAGTTCTGT[T/A]AGCCGGTGAGACACTGCACACTTTTATCACAAGGACTCTCAAAATCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17662
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052750 Essential Splice Site 1313 1760 22 30
Genomic Location:
Chromosome 7 (position 13263479)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCCGGGTCCGTTCTGGTGCCAACCTCACCCTGGAGTGTCCCGTCAAAG[G/A]TGAGTGAAGATTNNTACAGAAATTACTTTTTACATATTTAAAGAAGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20869
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052750 Essential Splice Site 1374 1760 23 30
Genomic Location:
Chromosome 7 (position 13246572)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAACACCATCGGCAAATCCGCTGCCTCCAGCCGGATCAGTGTGGAGG[G/A]TGAGTAAAGACCACGGGATACTTCAAAGAAAGGTTTTTTTGTGGGCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5398
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052750 Nonsense 1513 1760 26 30
Genomic Location:
Chromosome 7 (position 13237173)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGCTCGTCCTGTGGAAACAGAGGGAYTCAGATGAAGAAGATTAAATG[T/A]GTGTCGTCAGAGGGCAGAGAGTCTTCTCATGCAKCCTGTCATTATCTCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
  • Height: Genome-wide association analysis identifies 20 loci that influence adult height. (View Study)
  • Height: Genome-wide association study of height and body mass index in Australian twin families. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Identification of ten loci associated with height highlights new biological pathways in human growth. (View Study)
  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Height: Meta-analysis of genome-wide scans for human adult stature identifies novel Loci and associations with measures of skeletal frame size. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/clqqbwv6