grin1a

Ensembl ID:
ENSDARG00000027828
ZFIN ID:
ZDB-GENE-051202-1
Description:
glutamate receptor, ionotropic, N-methyl D-aspartate 1a [Source:RefSeq peptide;Acc:NP_001070182]
Human Orthologue:
GRIN1
Human Description:
glutamate receptor, ionotropic, N-methyl D-aspartate 1 [Source:HGNC Symbol;Acc:4584]
Mouse Orthologue:
Grin1
Mouse Description:
glutamate receptor, ionotropic, NMDA1 (zeta 1) Gene [Source:MGI Symbol;Acc:MGI:95819]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa133 Nonsense Confirmed mutation in F2 line During 2017
sa37246 Nonsense Mutation detected in F1 DNA During 2017
sa25151 Essential Splice Site Mutation detected in F1 DNA During 2017
sa7245 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa133
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041869   None 226 None 4
ENSDART00000102368 Nonsense 469 901 11 20
ENSDART00000126045 Nonsense 469 938 11 21
ENSDART00000129744 Nonsense 469 966 11 23
Genomic Location (Zv9):
Chromosome 21 (position 9915516)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11398879
KASP Assay ID:
554-0070.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGAAATTTCACTTTTTCTGGTTTGGTTACAGGACGCCCAATTGTACCC[C/T]AATGTTGCTACGGATTTTGCATTGACCTTCTGATCAAGTTGGCTTTAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37246
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041869   None 226 None 4
ENSDART00000102368 Nonsense 547 901 12 20
ENSDART00000126045 Nonsense 547 938 12 21
ENSDART00000129744 Nonsense 547 966 12 23
Genomic Location (Zv9):
Chromosome 21 (position 9915842)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11399205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTCCCTTGACGATCAACAATGAACGAGCCCAGTACATAGAATTTTCC[A/T]AGCCTTTCAAATACCAGGGACTCACTATCCTTGTGAAAAAGGTACGATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25151
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041869   None 226 None 4
ENSDART00000102368 Essential Splice Site 688 901 16 20
ENSDART00000126045 Essential Splice Site 688 938 16 21
ENSDART00000129744 Essential Splice Site 688 966 16 23
Genomic Location (Zv9):
Chromosome 21 (position 9916974)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11400337
KASP Assay ID:
554-7688.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCACCAAAGAAAAGGTTTTTAAGATTTATAAAACAAGTTTGCTTTTTTC[A/C]GCTGAGGAACCCATCAGACAAATTCATCTATGCCACAGTGAAGCAGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7245
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041869   None 226 None 4
ENSDART00000102368 Essential Splice Site 831 901 18 20
ENSDART00000126045 Essential Splice Site 831 938 18 21
ENSDART00000129744 Essential Splice Site 831 966 18 23
Genomic Location (Zv9):
Chromosome 21 (position 9918127)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11401490
KASP Assay ID:
554-5128.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTCAAGGAGCAATGCCCCAGCCACACTCACCTTTGAGAATATGGCAGG[T/G]ATGGTCCATTTCAGGTACAGAGTAACCTAAAAGAGATTGGACAAAAAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link