hdhd1

Ensembl ID:
ENSDARG00000027826
ZFIN ID:
ZDB-GENE-050522-36
Description:
haloacid dehalogenase-like hydrolase domain-containing protein 1A [Source:RefSeq peptide;Acc:NP_001
Human Orthologue:
HDHD1
Human Description:
haloacid dehalogenase-like hydrolase domain containing 1 [Source:HGNC Symbol;Acc:16818]
Mouse Orthologue:
Hdhd1a
Mouse Description:
haloacid dehalogenase-like hydrolase domain containing 1A Gene [Source:MGI Symbol;Acc:MGI:1914615]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19523 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19523
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037293 Nonsense 26 214 2 4
ENSDART00000135078 Nonsense 38 170 2 3
ENSDART00000137156 Nonsense 38 226 2 4
Genomic Location:
Chromosome 1 (position 31883254)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGATTGTACACAGTCTCGTTCCAGGAAGTTTGTGACAGGTTTAATAAG[C/T]AGTATACTTGGGAAGTGAAGTCCTCTGTTATGGGCAAAAAGGCTCTGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/i6hr6f4h