top1mt

Ensembl ID:
ENSDARG00000027824
ZFIN ID:
ZDB-GENE-040624-2
Description:
DNA topoisomerase I, mitochondrial [Source:RefSeq peptide;Acc:NP_001001838]
Human Orthologues:
TOP1, TOP1MT
Human Descriptions:
topoisomerase (DNA) I [Source:HGNC Symbol;Acc:11986]
topoisomerase (DNA) I, mitochondrial [Source:HGNC Symbol;Acc:29787]
Mouse Orthologues:
Top1, Top1mt
Mouse Descriptions:
DNA topoisomerase 1, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:1920210]
topoisomerase (DNA) I Gene [Source:MGI Symbol;Acc:MGI:98788]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14373 Essential Splice Site Available for shipment Available now
sa8050 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14373
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025550 Essential Splice Site 147 262 4 7
Genomic Location:
Chromosome 24 (position 43774280)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCAGCACCCAAAACMTTCGAGAAGTCCATGCAGCTGCTGCAAGARAAG[G/A]TGAGCAGACAAATACACACRCAATACTACACAWTAACNNNNNNNNNNAMA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8050
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025550 Essential Splice Site 179 262 5 7
Genomic Location:
Chromosome 24 (position 43775909)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGGCGAAGCAAGTGRATAAAGACACTCCGWCTGACAAATCCAGCAAG[T/C]GAGAAACGTTTCAKTGCAGGACTCAAGGTTACTGCAGTTCACGAACGCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/i7sj9vt4