LOC100331536

Ensembl ID:
ENSDARG00000027822
Human Orthologue:
OPN3
Human Description:
opsin 3 [Source:HGNC Symbol;Acc:14007]
Mouse Orthologue:
Opn3
Mouse Description:
opsin 3 Gene [Source:MGI Symbol;Acc:MGI:1338022]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21429 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21429
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032368 Nonsense 249 381 3 4
Genomic Location:
Chromosome 9 (position 6170954)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTAGGGAAGATACGCAAGACGGCTGCACGGAAACGGGAGTACCATGTGT[T/A]GTTCATGGTTATCACCACTGTGGTGTGTTACCTTTTGTGCTGGATGCCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yl9j4321