nus1

Ensembl ID:
ENSDARG00000027813
ZFIN ID:
ZDB-GENE-040718-48
Description:
Nogo-B receptor [Source:UniProtKB/Swiss-Prot;Acc:Q6DHR8]
Human Orthologue:
NUS1
Human Description:
nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:21042]
Mouse Orthologue:
Nus1
Mouse Description:
nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MG

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9491 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9491
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034054 Nonsense 133 274 2 5
ENSDART00000142791 Nonsense 88 212 2 5
Genomic Location (Zv9):
Chromosome 20 (position 42268603)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42339762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGTGTTTTTAAGAGGAATAACTCCAGACTGATGGAGRAGATCCTGAAA[C/T]AGCAGCAGGAGYTTTTGGGAATGGRCAGCTCCAAATATTCAGTGGAGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link