sbds

Ensembl ID:
ENSDARG00000027803
ZFIN ID:
ZDB-GENE-040426-1116
Description:
ribosome maturation protein SBDS [Source:RefSeq peptide;Acc:NP_957415]
Human Orthologue:
SBDS
Human Description:
Shwachman-Bodian-Diamond syndrome [Source:HGNC Symbol;Acc:19440]
Mouse Orthologue:
Sbds
Mouse Description:
Shwachman-Bodian-Diamond syndrome homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1913961]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa331 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa331
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038534 Nonsense 129 231 3 5
Genomic Location (Zv9):
Chromosome 15 (position 1884142)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1931264
KASP Assay ID:
554-3398.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTTATAGAGAGAGCCATGAAGGACATCCACTTCTCTGYTAAAGCAAAC[A/T]AAAGCACTAAACAGCAGGTCAGTAGATATTGATCATTGGAGGATCTGTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link