adcy6b

Ensembl ID:
ENSDARG00000027797
ZFIN ID:
ZDB-GENE-090127-2
Human Orthologue:
ADCY6
Human Description:
adenylate cyclase 6 [Source:HGNC Symbol;Acc:237]
Mouse Orthologue:
Adcy6
Mouse Description:
adenylate cyclase 6 Gene [Source:MGI Symbol;Acc:MGI:87917]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19326 Nonsense Mutation detected in F1 DNA During 2014
sa4228 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19326
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038491 Nonsense 1012 1049 21 21
ENSDART00000145332 Nonsense 1128 1165 22 22
ENSDART00000038491 Nonsense 1012 1049 21 21
ENSDART00000145332 Nonsense 1128 1165 22 22

The following transcripts of ENSDARG00000027797 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 27037961)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAATGCATAATAAAAGTTTCTTCTTTACCCCTACAGGTGACCACAGATT[T/A]GTACCATGTCCTAGAAAGTAAGGGCTACCAGCTGGAATGTCGTGGACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4228
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038491 Nonsense 1012 1049 21 21
ENSDART00000145332 Nonsense 1128 1165 22 22
ENSDART00000038491 Nonsense 1012 1049 21 21
ENSDART00000145332 Nonsense 1128 1165 22 22

The following transcripts of ENSDARG00000027797 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 27037961)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAATGCATAATAAAAGTTTCTTCTTTACCCCTACAGGTGACCACAGATT[T/A]GTACCATGTCCTAGAAAGTAAGGGCTACCAGCTGGAATGTCGTGGACTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ss0wgy82