si:ch211-274c22.6

Ensembl ID:
ENSDARG00000027777
ZFIN ID:
ZDB-GENE-081107-35
Human Orthologue:
TNFAIP3
Human Description:
tumor necrosis factor, alpha-induced protein 3 [Source:HGNC Symbol;Acc:11896]
Mouse Orthologue:
Tnfaip3
Mouse Description:
tumor necrosis factor, alpha-induced protein 3 Gene [Source:MGI Symbol;Acc:MGI:1196377]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22193 Nonsense Available for shipment Available now
sa35393 Nonsense Mutation detected in F1 DNA During 2017
sa35394 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa22194 Nonsense Available for shipment Available now
sa10832 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22193
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033528 Nonsense 33 762 1 8
ENSDART00000147959 Nonsense 28 756 1 8
Genomic Location (Zv9):
Chromosome 13 (position 1054254)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1052062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCCTGAAGGCGGTCAAAATCAGAGAGCGGGTGCCCAATGATGTGGTC[A/T]AACCCTCGGCAGGCGGCAGCCTGATCCATCACCTGCGGAGCATGCACCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35393
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033528 Nonsense 248 762 4 8
ENSDART00000147959 Nonsense 243 756 4 8
Genomic Location (Zv9):
Chromosome 13 (position 1073970)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1071778
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGGAATATACCTGCCTTTGCATTGGCCTCCAGGTGAATGCTACAAATA[T/A]CCCATAGTGCTCGGCTACGACTCGCAGCATTTTGCACCCCTGATCACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35394
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033528   None 762 None 8
ENSDART00000147959 Splice Site, Nonsense 311 756 6 8
Genomic Location (Zv9):
Chromosome 13 (position 1076920)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1074728
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTTTAAATCCAATTAATCATGATTAACACCACTAAACCTAAAATCTAG[C/T]AGCACGTTTGCCTTTTTAAAATCTCGAATGCTTTTTCCTCCAGACTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22194
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033528 Nonsense 355 762 6 8
ENSDART00000147959 Nonsense 349 756 6 8
Genomic Location (Zv9):
Chromosome 13 (position 1077036)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1074844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGATATGAACCTGATGGAGGATTACCTGCAGCTGGTGAACCACGAGTA[C/A]AAGCGCTGGCAGGAGGACAAGGACTCTCTCTGGGCCCCGCAGTCCCAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10832
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033528 Nonsense 570 762 6 8
ENSDART00000147959 Nonsense 564 756 6 8
Genomic Location (Zv9):
Chromosome 13 (position 1077679)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1075487
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGCAGGAGCCCAGGACGGAGGGTTCGGTSTGGGCAGAACGCAGTGGG[C/T]AGACCTGGCAGACGCCCGCRGCCMGACAGTGCAAACGCTCTGGATGCCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link