
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
dpp7
- Ensembl ID:
- ENSDARG00000027750
- ZFIN ID:
- ZDB-GENE-050306-16
- Description:
- dipeptidyl peptidase 2 [Source:RefSeq peptide;Acc:NP_001013333]
- Human Orthologue:
- DPP7
- Human Description:
- dipeptidyl-peptidase 7 [Source:HGNC Symbol;Acc:14892]
- Mouse Orthologue:
- Dpp7
- Mouse Description:
- dipeptidylpeptidase 7 Gene [Source:MGI Symbol;Acc:MGI:1933213]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa1751 | Essential Splice Site | Available for shipment | Available now |
sa9028 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa1751
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000037891 | Essential Splice Site | 126 | 500 | 3 | 13 |
ENSDART00000088827 | Essential Splice Site | 117 | 487 | 3 | 13 |
ENSDART00000137324 | Essential Splice Site | 133 | 242 | 3 | 6 |
- Genomic Location (Zv9):
- Chromosome 5 (position 30799515)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 28560872 GRCz11 5 29161025 - KASP Assay ID:
- 554-1744.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGTAGAGCTGGCAGCAGCGCAGGGAGCCCTGCTCATATTTGCTGAACAT[G/A]TAAGTTTCCCGAAACTGTCGTGAATCATATGACTATGGAGGAAGTAATGA
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa9028
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000037891 | Nonsense | 148 | 500 | 4 | 13 |
ENSDART00000088827 | Nonsense | 139 | 487 | 4 | 13 |
ENSDART00000137324 | Nonsense | 155 | 242 | 4 | 6 |
- Genomic Location (Zv9):
- Chromosome 5 (position 30801259)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 28562616 GRCz11 5 29162769 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATCTCTTCCATTTGGGAAGAATTCTTTTAAAATCCCTGAGGTGGGKTTGT[T/A]GACGGTGGAGCAGGCCCTCGCRGACTATGCTGTCATGATCACAGAGCTGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: