dpp7

Ensembl ID:
ENSDARG00000027750
ZFIN ID:
ZDB-GENE-050306-16
Description:
dipeptidyl peptidase 2 [Source:RefSeq peptide;Acc:NP_001013333]
Human Orthologue:
DPP7
Human Description:
dipeptidyl-peptidase 7 [Source:HGNC Symbol;Acc:14892]
Mouse Orthologue:
Dpp7
Mouse Description:
dipeptidylpeptidase 7 Gene [Source:MGI Symbol;Acc:MGI:1933213]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1751 Essential Splice Site Available for shipment Available now
sa9028 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa1751
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037891 Essential Splice Site 126 500 3 13
ENSDART00000088827 Essential Splice Site 117 487 3 13
ENSDART00000137324 Essential Splice Site 133 242 3 6
Genomic Location (Zv9):
Chromosome 5 (position 30799515)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28560872
KASP Assay ID:
554-1744.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTAGAGCTGGCAGCAGCGCAGGGAGCCCTGCTCATATTTGCTGAACAT[G/A]TAAGTTTCCCGAAACTGTCGTGAATCATATGACTATGGAGGAAGTAATGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa9028
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037891 Nonsense 148 500 4 13
ENSDART00000088827 Nonsense 139 487 4 13
ENSDART00000137324 Nonsense 155 242 4 6
Genomic Location (Zv9):
Chromosome 5 (position 30801259)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28562616
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTCTTCCATTTGGGAAGAATTCTTTTAAAATCCCTGAGGTGGGKTTGT[T/A]GACGGTGGAGCAGGCCCTCGCRGACTATGCTGTCATGATCACAGAGCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link