si:ch211-13c6.2

Ensembl ID:
ENSDARG00000027738
ZFIN ID:
ZDB-GENE-060503-666
Description:
hypothetical protein LOC100000125 [Source:RefSeq peptide;Acc:NP_001076407]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32259 Nonsense Available for shipment Available now
sa23587 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32259
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102726 Nonsense 67 344 6 9
ENSDART00000125579 Nonsense 105 804 5 13
ENSDART00000145356 Nonsense 105 536 6 10
Genomic Location (Zv9):
Chromosome 19 (position 43595311)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42474359
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCTGATCATGTCACTGAGGATGGCAAAAACGTGCTTAAGTACAAATGC[C/T]GAATGTGTTTTGTGGAGATGGACCTGTACAGTATGGTGACGCATATTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23587
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102726 Nonsense 109 344 7 9
ENSDART00000125579 Nonsense 147 804 6 13
ENSDART00000145356 Nonsense 147 536 7 10
Genomic Location (Zv9):
Chromosome 19 (position 43595518)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42474566
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGCTGAAAAGGCCAGACTTGGTGACCTGGAATGACAATAATCTGAAA[C/T]AGCCGGGTCTCGTGGTCAGAGCCAAAGCTGCAGTCGTGGAGAAGCACGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link