olfcg5

Ensembl ID:
ENSDARG00000027720
ZFIN ID:
ZDB-GENE-060503-913
Description:
similar to putative pheromone receptor CPpr4 [Source:RefSeq peptide;Acc:NP_001103413]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1104 Nonsense F2 line generated During 2017
sa30979 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa1104
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067567 Nonsense 157 833 2 6
Genomic Location (Zv9):
Chromosome 14 (position 17904140)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33016405
KASP Assay ID:
554-1006.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACATGCTATCATAGGAGAAACTGAGTCTTCTGCCACAGTGATTCTGTCC[A/T]GAACTACAGGACCTTTCAAAATTCCAGTGGTAAGGATCAAAGATTATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30979
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067567 Nonsense 713 833 6 6
Genomic Location (Zv9):
Chromosome 14 (position 17906314)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33018579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGGTTGATAATATCACCTCCATTTCCCTACAAAAATATGAAGTATTA[T/A]AAGGAAAAGATCATTCTTGAATGCAGTCTGGGTGCTACAATATGTTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link