olfcw1

Ensembl ID:
ENSDARG00000027697
ZFIN ID:
ZDB-GENE-050522-281
Description:
olfactory receptor C family, w1 [Source:RefSeq peptide;Acc:NP_001018157]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31617 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31617
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050502 Essential Splice Site 122 818 2 6
ENSDART00000139869 Essential Splice Site 97 784 1 5
Genomic Location (Zv9):
Chromosome 7 (position 71556312)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 32168743
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTCAATGGCCATTTCCAGACTCCTCAACCTTTTCCATATCCCGCTGG[T/C]GAGGGCAGATCAGCTAGGCAAAATAATTAGAAATTAAGGAACTCTGTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link