pold1

Ensembl ID:
ENSDARG00000027689
ZFIN ID:
ZDB-GENE-060429-1
Description:
DNA polymerase delta catalytic subunit [Source:RefSeq peptide;Acc:NP_001034899]
Human Orthologue:
POLD1
Human Description:
polymerase (DNA directed), delta 1, catalytic subunit 125kDa [Source:HGNC Symbol;Acc:9175]
Mouse Orthologue:
Pold1
Mouse Description:
polymerase (DNA directed), delta 1, catalytic subunit Gene [Source:MGI Symbol;Acc:MGI:97741]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17444 Essential Splice Site Available for shipment Available now
sa18749 Essential Splice Site Mutation detected in F1 DNA During 2017
sa12879 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17444
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055859 Essential Splice Site 63 1105 2 27
ENSDART00000137592   None 179 None 5
Genomic Location (Zv9):
Chromosome 3 (position 16337795)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16568014
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGTRGAGTCAGGGGAGGGGCAAGCTGGTCATGACGTCATCCCAGTAGG[T/G]GAGTRTGTCTTCTGCCTKGTTTTTAATTTGATTTATAGAGCTCTGGAAYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18749
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055859 Essential Splice Site 190 1105 6 27
ENSDART00000137592   None 179 None 5
Genomic Location (Zv9):
Chromosome 3 (position 16332311)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16562530
KASP Assay ID:
2259-3214.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATGTTATTAATTCTGAATGAATCCGTCTTTCGTGTTTTTTTTTTTTTT[A/T]GGTATGTATAATTACCATGGAAACAAACCTCATGACTTCCTGCGCATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12879
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055859 Nonsense 796 1105 19 27
ENSDART00000137592   None 179 None 5
Genomic Location (Zv9):
Chromosome 3 (position 16315901)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16546120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGGAGGCTGCTGAATGGGTCTCCTCCCACTTCGTTCCACCAATYAAAT[T/A]AGAATTTGAGAAGGTRAGCAAATCAGAATTATRCAACAAGATTAAWTMAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link