si:ch211-133l5.8

Ensembl ID:
ENSDARG00000027676
ZFIN ID:
ZDB-GENE-081104-118
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S4Z6]
Human Orthologue:
HARBI1
Human Description:
harbinger transposase derived 1 [Source:HGNC Symbol;Acc:26522]
Mouse Orthologue:
Harbi1
Mouse Description:
harbinger transposase derived 1 Gene [Source:MGI Symbol;Acc:MGI:2443194]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6097 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6097
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028842 Nonsense 50 457 1 2
ENSDART00000147267 Nonsense 50 259 1 2
Genomic Location (Zv9):
Chromosome 8 (position 21400194)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20830091
KASP Assay ID:
554-3924.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAACTACATATTAGAAAGGCGAGCAGAAATTCACAAAAGAATCCGATAT[C/T]GAAGGCATCTTTTCCAGAATTACCTGAGCACGAGAACGGTAAACCAYATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link