irf10

Ensembl ID:
ENSDARG00000027658
ZFIN ID:
ZDB-GENE-040426-2084
Description:
interferon regulatory factor 10 [Source:RefSeq peptide;Acc:NP_998044]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15779 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15779
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030643 Nonsense 193 392 7 9
ENSDART00000124850 None None 147 None 3
Genomic Location:
Chromosome 23 (position 665184)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTRTGTAGTGGACTG[T/A]CGTCWGGAGCTGCGTGTGTTCTACTAYGGGCGTGTGGTGGAGAGTGTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gu59b4e9