cpsf3

Ensembl ID:
ENSDARG00000027649
ZFIN ID:
ZDB-GENE-030131-3275
Description:
cleavage and polyadenylation specificity factor subunit 3 [Source:RefSeq peptide;Acc:NP_001003836]
Human Orthologue:
CPSF3
Human Description:
cleavage and polyadenylation specific factor 3, 73kDa [Source:HGNC Symbol;Acc:2326]
Mouse Orthologue:
Cpsf3
Mouse Description:
cleavage and polyadenylation specificity factor 3 Gene [Source:MGI Symbol;Acc:MGI:1859328]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23728 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23727 Nonsense Available for shipment Available now
sa11209 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23728
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040292 Essential Splice Site 24 690 1 18
ENSDART00000139469 None None 99 None 2
Genomic Location:
Chromosome 20 (position 29659228)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTACCAGTGCCTGCGGAAGAGAGTGATCAGCTCCTCATCAGACCGCTG[T/A]AAGTTCACTTCATTCACTGTCTTTAATAACAGTTCAGTTCCGCGCCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23727
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040292 Nonsense 408 690 10 18
ENSDART00000139469 None None 99 None 2
Genomic Location:
Chromosome 20 (position 29652037)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGATGTCAGTGGATTACATCTCATTCTCTGCTCATACAGACTACCAG[C/T]AGACCAGCGAGTTCATCCGAGCTCTGAAACCTCCTCATGTGGTCAGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11209
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040292 Essential Splice Site 603 690 15 18
ENSDART00000139469 None None 99 None 2
Genomic Location:
Chromosome 20 (position 29649030)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCACCACAGTGGTTCTGGAAGTGCAGTCAAAYCCCAAAGCTCAGAAAGG[T/G]GCATTTTTACACCAGATTAAATGTGCAACTGAAATCGTTTATTCAATATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x19ewyys