si:ch211-279i17.1

Ensembl ID:
ENSDARG00000027618
ZFIN ID:
ZDB-GENE-070705-172
Description:
Novel glutamate receptor interacting protein family [Source:UniProtKB/TrEMBL;Acc:A5WUM3]
Mouse Orthologue:
Grip2
Mouse Description:
glutamate receptor interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:2681173]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37555 Nonsense Mutation detected in F1 DNA During 2017
sa13297 Nonsense Available for shipment Available now
sa13477 Essential Splice Site Available for shipment Available now
sa32411 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37555
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092447 Nonsense 231 1118 7 24
ENSDART00000133267 Nonsense 118 923 4 20
Genomic Location (Zv9):
Chromosome 22 (position 34178027)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 31434232
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCGTGTTATTGTGCAGAGAAGGGACTCTAAAATCGGGTGACCGGATCT[T/A]AAGCGTGGATGGTGTGGTTTTACACAGCGCCACTCACAGTGATGCCCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13297
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092447 Nonsense 404 1118 10 24
ENSDART00000133267 Nonsense 291 923 7 20
Genomic Location (Zv9):
Chromosome 22 (position 34200125)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 31455249
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCTGTGTGAACTACTGCCATTCTCAACATCCTGGTCAYTGTAAGACAT[C/A]GACGTGGACATCTGCTTCCAGYAACCCTTCCAGCTCTCAGGATTACTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13477
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092447 Essential Splice Site 421 1118 10 24
ENSDART00000133267 Essential Splice Site 308 923 7 20
Genomic Location (Zv9):
Chromosome 22 (position 34200179)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 31455303
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGACATCTGCTTCCAGYAACCCTTCCAGCTCTCAGGATTACTGCAAAT[G/A]TAACTACAGTGTAMMATGCTGTTTTTATTWCWTTATAAGTAGTGSTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32411
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092447 Nonsense 1048 1118 23 24
ENSDART00000133267 Nonsense 881 923 19 20
Genomic Location (Zv9):
Chromosome 22 (position 34253496)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 31508620
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATGATCAGACCTGAGGGTCCGGCAGACCGCGCTGGGCTCAAACCCTA[C/A]GACAGGATCCTTCAGGTGCCTCTTCTCAGATCTCCAGCTATACGATCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link