gatad1

Ensembl ID:
ENSDARG00000027612
ZFIN ID:
ZDB-GENE-050629-1
Description:
GATA zinc finger domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q1L8G7]
Human Orthologue:
GATAD1
Human Description:
GATA zinc finger domain containing 1 [Source:HGNC Symbol;Acc:29941]
Mouse Orthologue:
Gatad1
Mouse Description:
GATA zinc finger domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1914460]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43344 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43344
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051712 Essential Splice Site 121 242 3 5
Genomic Location (Zv9):
Chromosome 19 (position 45480232)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44378454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGAGTCTGTTTCAACGATCATCACATCAGAGTCCATGTTTTACAAGG[T/G]AACAGTTTTAAATGAATATTCACAGTGTTTTTCTGTCTGCCACTTTCTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link