selt1b

Ensembl ID:
ENSDARG00000027595
ZFIN ID:
ZDB-GENE-030411-1
Description:
selenoprotein T1b precursor [Source:RefSeq peptide;Acc:NP_840077]
Human Orthologue:
RP11-392O18.1
Human Description:
Selenoprotein T [Source:UniProtKB/Swiss-Prot;Acc:P62341]
Mouse Orthologue:
2810407C02Rik
Mouse Description:
RIKEN cDNA 2810407C02 gene Gene [Source:MGI Symbol;Acc:MGI:1916477]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36715 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36715
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077452 Splice Site, Nonsense 47 193 2 7
ENSDART00000146972   None 193 None 6
Genomic Location (Zv9):
Chromosome 18 (position 39869953)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41539450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGGTTGACGGGTATGGTTTTTCGACTGCATATTCAGGTTAGTGTGTCA[C/T]AAGTAGGGTTGTCACAATACTGGAATTTGGTACCAATCCAAACTGAAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link