sept2

Ensembl ID:
ENSDARG00000027590
ZFIN ID:
ZDB-GENE-030131-911
Description:
Septin 2 [Source:UniProtKB/TrEMBL;Acc:B0S7M6]
Human Orthologue:
SEPT2
Human Description:
septin 2 [Source:HGNC Symbol;Acc:7729]
Mouse Orthologue:
Sept2
Mouse Description:
septin 2 Gene [Source:MGI Symbol;Acc:MGI:97298]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32902 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32902
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038514 Nonsense 16 252 1 8
ENSDART00000056966 Nonsense 167 341 6 11
ENSDART00000125514 Nonsense 171 394 7 14
ENSDART00000126891 Nonsense 16 239 1 8
ENSDART00000130603 Nonsense 177 413 6 13
Genomic Location (Zv9):
Chromosome 2 (position 22059990)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22946695
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAGTTTTAACACCATTATCTCATACATCGATGACCAGTTTGAGCGCTA[T/A]CTACATGACGAGAGTGGACTGAACCGCAGACACATTGTGGACAACCGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link