fzd7b

Ensembl ID:
ENSDARG00000027589
ZFIN ID:
ZDB-GENE-990415-229
Description:
frizzled homolog 7b [Source:RefSeq peptide;Acc:NP_739569]
Human Orthologue:
FZD7
Human Description:
frizzled homolog 7 (Drosophila) [Source:HGNC Symbol;Acc:4045]
Mouse Orthologue:
Fzd7
Mouse Description:
frizzled homolog 7 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:108570]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
hu3495 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu3495
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039280 Nonsense 477 557 2 2
Genomic Location:
Chromosome 6 (position 8021813)
KASP Assay ID:
554-0091.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCTACACCGTTCCTGCAACCATCGTCATTGCGTGTTACTTCTACGAA[C/T]AGGCGTTTCGTGAGCAGTGGGAAAAAACCTGGCATATGCAAACGTGCAAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1nyn1gca