top3b

Ensembl ID:
ENSDARG00000027586
ZFIN ID:
ZDB-GENE-070705-37
Description:
Novel protein similar to vertebrate topoisomerase (DNA) III beta (TOP3B) [Source:UniProtKB/TrEMBL;Ac
Human Orthologue:
TOP3B
Human Description:
topoisomerase (DNA) III beta [Source:HGNC Symbol;Acc:11993]
Mouse Orthologue:
Top3b
Mouse Description:
topoisomerase (DNA) III beta Gene [Source:MGI Symbol;Acc:MGI:1333803]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5286 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5286
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030553 Nonsense 358 862 9 17
ENSDART00000133460 None None 193 None 5
Genomic Location:
Chromosome 5 (position 14432086)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACCACACATTATCCTGAAAACTTCGACCTGAAGGGCACCCTCAAACAR[C/T]AGGCCAACAGCACCTTCTGGGGTGAAACGGTGAGCGATATTGTCTTTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/266utpnu