PAK6 (1 of 2)

Ensembl ID:
ENSDARG00000027564
Description:
p21 protein (Cdc42/Rac)-activated kinase 6 [Source:HGNC Symbol;Acc:16061]
Human Orthologue:
PAK6
Human Description:
p21 protein (Cdc42/Rac)-activated kinase 6 [Source:HGNC Symbol;Acc:16061]
Mouse Orthologue:
Pak6
Mouse Description:
p21 protein (Cdc42/Rac)-activated kinase 6 Gene [Source:MGI Symbol;Acc:MGI:2679420]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42843 Nonsense Mutation detected in F1 DNA During 2017
sa9627 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42843
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103775 Nonsense 81 693 2 10
Genomic Location (Zv9):
Chromosome 17 (position 1607108)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2050057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTTCCACAGACCATTGTGCGGGGCAGTATGATTGGCCACGGGGATTA[C/A]ATCTCTGCCATGTTGTCCGACATGAGCCGTCTGTCAGTCACCAGCTCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9627
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103775 Nonsense 455 693 5 10
Genomic Location (Zv9):
Chromosome 17 (position 1620143)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2063092
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAACACAGCGGACGCGTGGTGGCCGTCAAGATGATGGAYYTGAGGAGA[C/T]AGCAGAGGAGAGAACTKCTCTTCAATGAGGTKAYACACACCACCMGCAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link