mapk1

Ensembl ID:
ENSDARG00000027552
ZFIN ID:
ZDB-GENE-030722-2
Description:
mitogen-activated protein kinase 1 [Source:RefSeq peptide;Acc:NP_878308]
Human Orthologue:
MAPK1
Human Description:
mitogen-activated protein kinase 1 [Source:HGNC Symbol;Acc:6871]
Mouse Orthologue:
Mapk1
Mouse Description:
mitogen-activated protein kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1346858]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33547 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33547
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030213 Nonsense 69 369 2 9
Genomic Location (Zv9):
Chromosome 5 (position 14334208)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12631645
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACCGTGACAATAAAGTACGTGTGGCGATCAAGAAGATCAGCCCGTTT[G/T]AGCACCAGACGTACTGTCAGCGCACACTGCGTGAGATTAAAATCCTGCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link