C14orf148

Ensembl ID:
ENSDARG00000027538
Description:
chromosome 14 open reading frame 148 [Source:HGNC Symbol;Acc:20487]
Human Orthologue:
C14orf148
Human Description:
chromosome 14 open reading frame 148 [Source:HGNC Symbol;Acc:20487]
Mouse Orthologue:
4933437F05Rik
Mouse Description:
RIKEN cDNA 4933437F05 gene Gene [Source:MGI Symbol;Acc:MGI:1918525]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42997 Nonsense Mutation detected in F1 DNA During 2016
sa15278 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42997
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036442 Nonsense 241 340 6 7
ENSDART00000062109 Nonsense 230 332 5 6
ENSDART00000062111 Nonsense 240 335 6 7
Genomic Location:
Chromosome 17 (position 45322214)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTAAGTAAACTGGCAGTGTTTACTGAAGGTGGGCTCTTCCTGGATCGA[C/T]GATGGACGTCTGCTGTGCTCTACGCTCTCCTCAACATGTGCACAGCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15278
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036442 Nonsense 254 340 6 7
ENSDART00000062109 Nonsense 243 332 5 6
ENSDART00000062111 Nonsense 253 335 6 7
Genomic Location:
Chromosome 17 (position 45322173)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNNNNNNNATCGACGATGGACGTCTGCTGTGYTYTACGCTCTCCTCAACATGTG[C/A]ACAGCAGAAAAGCTGGACTCSGGAAACACTCTTCWGCTGCYAAATRGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link