usp20

Ensembl ID:
ENSDARG00000027501
ZFIN IDs:
ZDB-GENE-040426-1219, ZDB-GENE-040426-1219, ZDB-GENE-040426-1219
Description:
Ubiquitin carboxyl-terminal hydrolase 20 [Source:UniProtKB/Swiss-Prot;Acc:A5PN09]
Human Orthologue:
USP20
Human Description:
ubiquitin specific peptidase 20 [Source:HGNC Symbol;Acc:12619]
Mouse Orthologue:
Usp20
Mouse Description:
ubiquitin specific peptidase 20 Gene [Source:MGI Symbol;Acc:MGI:1921520]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25304 Nonsense Mutation detected in F1 DNA During 2014
sa17352 Essential Splice Site Available for shipment Available now
sa10888 Nonsense Available for shipment Available now
sa8194 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25304
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006021 Nonsense 68 913 5 25
ENSDART00000030969 Nonsense 68 88 6 7
ENSDART00000097945 Nonsense 68 898 4 24
ENSDART00000111946 Nonsense 68 340 5 11
ENSDART00000122077 Nonsense 68 340 5 14
Genomic Location:
Chromosome 5 (position 34920311)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTACATTTTTGTACATCTGTTTATCTTCTTTTAACTATTTTCCAGGCC[A/T]AAAAGCACAATCTGACAGTAAACCTGACCACATTCAGGGTGTGGTGTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17352
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006021 Essential Splice Site 207 913 8 25
ENSDART00000030969 None None 88 None 7
ENSDART00000097945 Essential Splice Site 207 898 7 24
ENSDART00000111946 Essential Splice Site 207 340 8 11
ENSDART00000122077 Essential Splice Site 207 340 8 14
Genomic Location:
Chromosome 5 (position 34922506)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTAAAAGCTATCAGAAGCTTATCTCTGAACTCTGGCACAAGAAACGG[T/A]AACAAGCACTGACTTGCCAGACCGYTAACGWAGATCTGGCCTGTTCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10888
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006021 Nonsense 507 913 13 25
ENSDART00000030969 None None 88 None 7
ENSDART00000097945 Nonsense 492 898 13 24
ENSDART00000111946 None None 340 None 11
ENSDART00000122077 None None 340 None 14
Genomic Location:
Chromosome 5 (position 34928872)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCATTCACCAGAGTGCACCTGTKAAAGCTGGTGTCTGCACTGATGGCTA[T/G]GCTGCACAGGGCTGGATCTCCTACATCATGGACTCTATACGAAGGTATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8194
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006021 Nonsense 795 913 21 25
ENSDART00000030969 None None 88 None 7
ENSDART00000097945 Nonsense 778 898 21 24
ENSDART00000111946 None None 340 None 11
ENSDART00000122077 None None 340 None 14
Genomic Location:
Chromosome 5 (position 34936910)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTATATGTGTGTGCWATTTGCCAAGTGGAGATCGARACCTTAGCCAAA[C/T]GACGGAAACTGGAGATAGACACCTTCATTAAGGTGAACAAATGACCATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s1lhh65j