NP_957469.2

Ensembl ID:
ENSDARG00000027500
Description:
serine/threonine-protein kinase OSR1 [Source:RefSeq peptide;Acc:NP_957469]
Human Orthologue:
OXSR1
Human Description:
oxidative-stress responsive 1 [Source:HGNC Symbol;Acc:8508]
Mouse Orthologue:
Oxsr1
Mouse Description:
oxidative-stress responsive 1 Gene [Source:MGI Symbol;Acc:MGI:1917378]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11136 Essential Splice Site Available for shipment Available now
sa32484 Essential Splice Site Available for shipment Available now
sa12690 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11136
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106160 Essential Splice Site 61 520 2 18
ENSDART00000147004   None 423 None 15
Genomic Location (Zv9):
Chromosome 24 (position 20735413)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 19982542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAACGCAKCAATCWGGAGAAATGCCAGACCAGCATGGATGAGCTCCTGG[T/A]ACTGAAACTCTTATTACTTCATTAACYTGCAAATGTGCTTGGGTTCAYTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32484
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106160 Essential Splice Site 145 520 4 18
ENSDART00000147004 Essential Splice Site 48 423 1 15
Genomic Location (Zv9):
Chromosome 24 (position 20703803)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 19950932
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGCTTCAGGGTCTCGAGTACCTTCACAAAAATGGACAGATTCATAGG[T/A]AAATCACTTCTGTACATTTTTGAAATGCTTCAAGAAACATCAAGAAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12690
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106160 Essential Splice Site 279 520 8 18
ENSDART00000147004 Essential Splice Site 182 423 5 15
Genomic Location (Zv9):
Chromosome 24 (position 20691278)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 19938407
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGAGGAAGATGATCTCGCAGTGTTTGCAGAAAGAGCCRGAGAAAAGG[T/A]GCTTAGCAAAGCTGCATGTTGTTGTTGTTGGGTCATCATGTAAWAATAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link