mast1

Ensembl ID:
ENSDARG00000027497
Human Orthologue:
MAST1
Human Description:
microtubule associated serine/threonine kinase 1 [Source:HGNC Symbol;Acc:19034]
Mouse Orthologue:
Mast1
Mouse Description:
microtubule associated serine/threonine kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1861901]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12456 Nonsense Available for shipment Available now
sa16788 Nonsense Available for shipment Available now
sa32768 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12456
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063938 Nonsense 78 1717 4 26
Genomic Location:
Chromosome 1 (position 51849084)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGCTGATGGCAGAYGCTGGTCTCTGGCTTCTCTTCCCTCGTCTGGATA[T/A]GGGACCAACACACCCAGCTCAACGGTACAAACTCATCCACACAGAGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16788
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063938 Nonsense 383 1717 12 26
Genomic Location:
Chromosome 1 (position 51869710)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGGCACAGAGAAACTCGACAGCGCTTTGCAATGAAGAAGATCAACAAA[C/T]AGAACCTGATCCTGCGGAACCAGATCCAGCAGGCGTTCGTGGAGCGGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32768
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063938 Essential Splice Site 652 1717 17 26
Genomic Location:
Chromosome 1 (position 51877631)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTTCATCCCTCATCTTGAGTCTGAAGAGGACACCAGCTACTTCGACAG[T/C]GAGGACACTCGCATTAGTCTGTCCTTGATAGTCATCGCTCTATATCTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link