mast1

Ensembl ID:
ENSDARG00000027497
Human Orthologue:
MAST1
Human Description:
microtubule associated serine/threonine kinase 1 [Source:HGNC Symbol;Acc:19034]
Mouse Orthologue:
Mast1
Mouse Description:
microtubule associated serine/threonine kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1861901]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12456 Nonsense Available for shipment Available now
sa16788 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12456
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063938 Nonsense 78 1717 4 26
Genomic Location:
Chromosome 1 (position 51849084)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGCTGATGGCAGAYGCTGGTCTCTGGCTTCTCTTCCCTCGTCTGGATA[T/A]GGGACCAACACACCCAGCTCAACGGTACAAACTCATCCACACAGAGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16788
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063938 Nonsense 383 1717 12 26
Genomic Location:
Chromosome 1 (position 51869710)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGGCACAGAGAAACTCGACAGCGCTTTGCAATGAAGAAGATCAACAAA[C/T]AGAACCTGATCCTGCGGAACCAGATCCAGCAGGCGTTCGTGGAGCGGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3nq7xmzq