gphb5

Ensembl ID:
ENSDARG00000027472
ZFIN ID:
ZDB-GENE-090319-4
Description:
glycoprotein hormone beta 5 [Source:RefSeq peptide;Acc:NP_001159810]
Human Orthologue:
GPHB5
Human Description:
glycoprotein hormone beta 5 [Source:HGNC Symbol;Acc:18055]
Mouse Orthologue:
Gphb5
Mouse Description:
glycoprotein hormone beta 5 Gene [Source:MGI Symbol;Acc:MGI:2156540]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35562 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35562
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035011 Nonsense 68 134 2 3
ENSDART00000144387 Nonsense 68 69 3 4
Genomic Location (Zv9):
Chromosome 13 (position 37683150)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37159962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGATGCGGAGGCCTGCACATCACCACTGACGCCTGCTGGGGGCGCTGC[G/T]AGACCTGGCAAGTAAGACTGCTTTCCTATTAACCTGTAAATACAGAGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link