rpp30

Ensembl ID:
ENSDARG00000027428
ZFIN ID:
ZDB-GENE-050320-45
Description:
ribonuclease P protein subunit p30 [Source:RefSeq peptide;Acc:NP_001013497]
Human Orthologue:
RPP30
Human Description:
ribonuclease P/MRP 30kDa subunit [Source:HGNC Symbol;Acc:17688]
Mouse Orthologue:
Rpp30
Mouse Description:
ribonuclease P/MRP 30 subunit (human) Gene [Source:MGI Symbol;Acc:MGI:1859683]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38878 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41999 Essential Splice Site Mutation detected in F1 DNA During 2016
sa19035 Nonsense Mutation detected in F1 DNA During 2016
sa10410 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38878
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037601 Essential Splice Site 46 265 2 11
Genomic Location (Zv9):
Chromosome 12 (position 17522571)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16402327
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAACGGTTGCAATAAACTATGTAGTTGAGCCACTACAGAAGAAACAGG[T/C]ACAATATAGAGGAGTTAAACTAAACTGCATTATCGAGTTGTGCGTGCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41999
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037601 Essential Splice Site 87 265 4 11
Genomic Location (Zv9):
Chromosome 12 (position 17522277)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16402033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGTGCTAAATCGATTGACCATTGTGGCATCTGATGCATCACATTTTG[T/C]AAGTTTATACTTCGTAAACTCTAATATAATTTGTGCTAAAGTATTATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19035
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037601 Nonsense 222 265 10 11
ENSDART00000037601 Nonsense 222 265 10 11
Genomic Location (Zv9):
Chromosome 12 (position 17518209)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16397919
KASP Assay ID:
2260-5187.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCAGCTTGTCTGAGGGGGACGCTAAAGCTGCTGTGTCAACTAACTGT[C/T]GATCTGTCTTGCTACATGGAGGTAAATAATTGAAACTATAAGTCTCACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10410
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037601 Nonsense 222 265 10 11
ENSDART00000037601 Nonsense 222 265 10 11
Genomic Location (Zv9):
Chromosome 12 (position 17518209)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16397919
KASP Assay ID:
2260-5187.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCAGCTTGTCTGAGGGGGACGCTAAAGCTGCTGTGTCAACTAACTGT[C/T]GATCTGTCTTGCTACATGGAGGYAAATAAKTGAAACTATAAGTCTCACTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link