igf1ra

Ensembl ID:
ENSDARG00000027423
ZFIN ID:
ZDB-GENE-020503-1
Description:
insulin-like growth factor 1a receptor [Source:RefSeq peptide;Acc:NP_694500]
Human Orthologue:
IGF1R
Human Description:
insulin-like growth factor 1 receptor [Source:HGNC Symbol;Acc:5465]
Mouse Orthologue:
Igf1r
Mouse Description:
insulin-like growth factor I receptor Gene [Source:MGI Symbol;Acc:MGI:96433]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43094 Nonsense Mutation detected in F1 DNA During 2017
sa36640 Nonsense Available for shipment Available now
sa9079 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36639 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010189 Nonsense 263 1405 3 21

The following transcripts of ENSDARG00000027423 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 20703814)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20934037
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGAAGCAGACAATGATAAAGCATGCGCCGCCTGCCAGCATTACTTTCAC[G/T]AGGACCGATGTGTCGAGGCCTGCCCGCCAGATACCTACAAGTTTGAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36640
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010189 Nonsense 524 1405 7 21

The following transcripts of ENSDARG00000027423 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 20695341)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20925564
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATATCGACCGCCAGACTACAGAGACCTCATCAGCTTCATTGTGTATTA[C/A]AAGGAGGCGTAAGTACCAGTTACTATTGTAAACCTATTTTTCACTTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9079
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010189 Essential Splice Site 527 1405 7 21

The following transcripts of ENSDARG00000027423 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 20695332)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20925555
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGYCAGACTACAGAGACCTCATCAGCTTCATTGTGTATTACAAGGAGGC[G/A]TAAGTACCAGTTACTATTGTAAACCTATTTTTCAYTWCCAGCTGGGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36639
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010189 Nonsense 1201 1405 20 21

The following transcripts of ENSDARG00000027423 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 20672631)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20902854
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGTATCACCTTGTTCCTCTTTTTGCAGGTCGTTTGGTGTGGTTTTAT[G/A]GGAGATCGCCACATTAGCCGAACAGCCCTACCAGGGCATGTCCAACGAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Arthritis (juvenile idiopathic): Genome-wide association analysis of juvenile idiopathic arthritis identifies a new susceptibility locus at chromosomal region 3q13. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link