gad1b

Ensembl ID:
ENSDARG00000027419
ZFIN ID:
ZDB-GENE-030909-3
Description:
glutamate decarboxylase 1 [Source:RefSeq peptide;Acc:NP_919400]
Human Orthologue:
GAD1
Human Description:
glutamate decarboxylase 1 (brain, 67kDa) [Source:HGNC Symbol;Acc:4092]
Mouse Orthologues:
AC101882.1, Gad1
Mouse Description:
glutamic acid decarboxylase 1 Gene [Source:MGI Symbol;Acc:MGI:95632]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15783 Nonsense Available for shipment Available now
sa17561 Essential Splice Site Available for shipment Available now
sa2304 Nonsense Available for shipment Available now
sa13138 Nonsense Available for shipment Available now
sa900 Essential Splice Site Available for shipment Available now
sa20613 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15783
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003008 None None 587 None 17
ENSDART00000122348 Nonsense 290 613 9 17

The following transcripts of ENSDARG00000027419 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 3665244)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTAAACACAGCGGCTGTCTCCCTCTAGAGGACAGCATTATTAATGCGG[G/T]AAAGTGGATCTGTTTTGGACCATTTGATTGATGGCCGKCCATTWCTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17561
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003008 Essential Splice Site 309 587 None 17
ENSDART00000122348 Essential Splice Site 335 613 None 17

The following transcripts of ENSDARG00000027419 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 3665382)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTGGATTTGGSAAAGAAAACGTCATTCTCCTGAAGACAGATGAGAGG[T/C]ATGGCGTACAGTGTAYACCTGACATGTTTATTATAWTTTTGTAATTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2304
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003008 Nonsense 439 587 14 17
ENSDART00000122348 Nonsense 465 613 14 17
ENSDART00000003008 Nonsense 439 587 14 17
ENSDART00000122348 Nonsense 465 613 14 17

The following transcripts of ENSDARG00000027419 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 3671259)
KASP Assay ID:
554-2874.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTGCGCAGGTTACCTCTTCCAGCCGGACAAACAGTACGACGTGACCTA[C/A]GACACCGGAGACAAGGCCATCCAGTGCGGCAGACATGTGGACATCTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13138
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003008 Nonsense 439 587 14 17
ENSDART00000122348 Nonsense 465 613 14 17
ENSDART00000003008 Nonsense 439 587 14 17
ENSDART00000122348 Nonsense 465 613 14 17

The following transcripts of ENSDARG00000027419 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 3671259)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTGCGCAGGTTACCTCTTCCAGCCGGACAAACAGTACGACRTGACCTA[C/A]GACACCGGAGACAAGGCCATYCAGTGCGGCAGACATGTGGACATCTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa900
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003008 Essential Splice Site 501 587 16 17
ENSDART00000122348 Essential Splice Site 527 613 16 17

The following transcripts of ENSDARG00000027419 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 3673829)
KASP Assay ID:
554-0807.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTAATACTGCTGCTAATGGGTTTTTTATTGCTTTCCTCTGCTCTCCAT[A/T]GCCCCAGCACACTAATGTTTGCTTCTGGTATATTCCACCGAGTCTGCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20613
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003008 Nonsense 542 587 17 17
ENSDART00000122348 Nonsense 568 613 17 17

The following transcripts of ENSDARG00000027419 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 3675554)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGACTCTCCTGCAGGTGGCGCCAAAAATCAAAGCAATGATGATGGAGTG[C/A]GGCACCACCATGGTGGGTTACCAACCACAGGGAGACAAAGTCAACTTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/frbxrgfc