trappc4

Ensembl ID:
ENSDARG00000027418
ZFIN ID:
ZDB-GENE-040426-1734
Description:
trafficking protein particle complex 4 [Source:RefSeq peptide;Acc:NP_957058]
Human Orthologue:
TRAPPC4
Human Description:
trafficking protein particle complex 4 [Source:HGNC Symbol;Acc:19943]
Mouse Orthologue:
Trappc4
Mouse Description:
trafficking protein particle complex 4 Gene [Source:MGI Symbol;Acc:MGI:1926211]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10743 Nonsense Available for shipment Available now
sa19103 Nonsense Mutation detected in F1 DNA During 2014
sa4591 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10743
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033411 Nonsense 85 219 2 5
Genomic Location:
Chromosome 15 (position 9462736)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGACGTGAATGGTAAATTCACTGCGGAAGGGAAGGAGATYCAGGAGTA[T/G]CTGAGAGATCCTGCAAACTATCCAGTGTCCATCAGATTCGGCAGAYAGAR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19103
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033411 Nonsense 200 219 5 5
ENSDART00000033411 Nonsense 200 219 5 5
Genomic Location:
Chromosome 15 (position 9457437)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATAACAAAAAAACAATGCTTAATTTTCTTTCAGATGTGAACTATTTGAC[C/T]AAAACCTAAAGAGTGCCCTGGAAATAGCAGAGAAAGCAGGGACGTTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4591
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033411 Nonsense 200 219 5 5
ENSDART00000033411 Nonsense 200 219 5 5
Genomic Location:
Chromosome 15 (position 9457437)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATAACAAAAAAANNCAATGCTTAATTKTCTTTCAGATGTGAACTRTTTGAC[C/T]AAAACCTAAAGAGTGCCCTGGAAATAGCAGAGAAAGCAGGGACGTTTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dvok2o4h