trappc4

Ensembl ID:
ENSDARG00000027418
ZFIN ID:
ZDB-GENE-040426-1734
Description:
trafficking protein particle complex 4 [Source:RefSeq peptide;Acc:NP_957058]
Human Orthologue:
TRAPPC4
Human Description:
trafficking protein particle complex 4 [Source:HGNC Symbol;Acc:19943]
Mouse Orthologue:
Trappc4
Mouse Description:
trafficking protein particle complex 4 Gene [Source:MGI Symbol;Acc:MGI:1926211]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32015 Nonsense Available for shipment Available now
sa10743 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32015
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033411 Nonsense 22 219 1 5
Genomic Location (Zv9):
Chromosome 15 (position 9463019)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9345781
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTATGTTGTCAATAAAGCTGGTGGACTTATTTACCAGTACGATAATTA[T/A]GTACCTCGAGCTGAAGTGGAAAAAACATTTAGCTTTCCGCTCGATTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10743
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033411 Nonsense 85 219 2 5
Genomic Location (Zv9):
Chromosome 15 (position 9462736)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9345498
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGACGTGAATGGTAAATTCACTGCGGAAGGGAAGGAGATYCAGGAGTA[T/G]CTGAGAGATCCTGCAAACTATCCAGTGTCCATCAGATTCGGCAGAYAGAR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link