LOC559304

Ensembl ID:
ENSDARG00000027394

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9086 Nonsense Mutation detected in F1 DNA During 2016
sa40933 Nonsense Mutation detected in F1 DNA During 2016
sa30889 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126565 Nonsense 128 293 2 4
Genomic Location (Zv9):
Chromosome 7 (position 34071083)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32465423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGTCTGCTTTTGTGCAATATTTGATTGACTGTTTTGTTCAAACAGGST[T/A]GATCCAGAGATGCACCCCAGTGAAGTATCATTACACCTCTTCAATCCWGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40933
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126565 Nonsense 274 293 4 4
ENSDART00000126565 Nonsense 274 293 4 4
Genomic Location (Zv9):
Chromosome 7 (position 34076867)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32471207
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGGCCTCACCCTGCTGGCCGGTTTCTTATGCACACTGGCTCCTTCTT[T/A]AAGCAGCCCGCTGGCCCGCACCACAGTCCACAAGTCCAGGCACGAAAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30889
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126565 Nonsense 274 293 4 4
ENSDART00000126565 Nonsense 274 293 4 4
Genomic Location (Zv9):
Chromosome 7 (position 34076867)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32471207
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGGCCTCACCCTGCTGGCCGGTTTCTTATGCACACTGGCTCCTTCTT[T/A]AAGCAGCCCGCTGGCCCGCACCACAGTCCACAAGTCCAGGCACGAAAACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link