C9orf93

Ensembl ID:
ENSDARG00000027381
Description:
chromosome 9 open reading frame 93 [Source:HGNC Symbol;Acc:29828]
Human Orthologue:
C9orf93
Human Description:
chromosome 9 open reading frame 93 [Source:HGNC Symbol;Acc:29828]
Mouse Orthologue:
4930473A06Rik
Mouse Description:
RIKEN cDNA 4930473A06 gene Gene [Source:MGI Symbol;Acc:MGI:1922152]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24415 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24415
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036644 Nonsense 104 285 3 9
ENSDART00000102447 Nonsense 104 335 3 10
Genomic Location:
Chromosome 23 (position 44942912)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTCTGAGCTCAGAGCTCCGTCAGAGAGTGTCAGATCTTCAGAGGTCTT[T/A]AGAGATAACGCAGAGAGCCAGAGAAGATGACCTGCAGGGCCTCCAGGCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nyn8jfgj