cd2bp2

Ensembl ID:
ENSDARG00000027357
ZFIN ID:
ZDB-GENE-040426-925
Description:
CD2 antigen cytoplasmic tail-binding protein 2 [Source:RefSeq peptide;Acc:NP_957255]
Human Orthologue:
CD2BP2
Human Description:
CD2 (cytoplasmic tail) binding protein 2 [Source:HGNC Symbol;Acc:1656]
Mouse Orthologue:
Cd2bp2
Mouse Description:
CD2 antigen (cytoplasmic tail) binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1917483]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40099 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035759 Nonsense 278 378 5 7
ENSDART00000132679   None 122 None 5
ENSDART00000139410   None 167 None 5
Genomic Location (Zv9):
Chromosome 3 (position 32974932)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32706242
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAAAACTGGCCTACCAGCTGAAGGGGATGACTAGAGGAAAAGCAGCC[A/T]AAACACTAGGGGATGAAGAGGAGGATAAAGATGAGCTTGACATGTTTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link