mpzl2

Ensembl ID:
ENSDARG00000027345
ZFIN ID:
ZDB-GENE-030131-8774
Description:
myelin protein zero-like protein 2 [Source:RefSeq peptide;Acc:NP_997928]
Human Orthologue:
MPZL2
Human Description:
myelin protein zero-like 2 [Source:HGNC Symbol;Acc:3496]
Mouse Orthologue:
Mpzl2
Mouse Description:
myelin protein zero-like 2 Gene [Source:MGI Symbol;Acc:MGI:1289160]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa209 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa209
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031719 Nonsense 84 199 3 4
ENSDART00000122412 Nonsense 90 205 4 5
ENSDART00000129851 Nonsense 81 146 3 5

The following transcripts of ENSDARG00000027345 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 39553977)
KASP Assay ID:
554-0114.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATTCCCTTTCTTTCTTTTTCAGTTTTTCCACTACCAGGGACATGCATA[T/A]CTTCCTCCTGGCGGCCTGTTTAAGGATCATGTGGTATGGTCTGGTGATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/77onrp8h